BC200
Species: Homo sapiens
Position: chr2: 47335314-47335514
Known as: BCYRN1 , ENSG00000236824
Transcript: NR_001568 , ENST00000418539
Sequence: Download
Description:
BC200 lncRNA is upregulated in breast cancer; among breast tumor specimens there is a higher level of BC200 in estrogen receptor (ER) positive than in ER-negative tumors. Further experiments show that activation of estrogen signaling induces expression of BC200. BC200 Knockout suppresses tumor cell growth in vitro and in vivo by expression of the pro-apoptotic Bcl-xS isoform. Mechanistically, BC200 contains a 17-nucleotide sequence complementary to Bcl-x pre-mRNA, which may facilitate its binding to Bcl-x pre-mRNA and recruitment of heterogeneous nuclear ribonucleoprotein (hnRNP) A2/B1, a known splicing factor. Consequently, hnRNP A2/B1 interferes with association of Bcl-x pre-mRNA with the Bcl-xS-promoting factor Sam68, leading to a blockade of Bcl-xS expression. Together, these results suggest that BC200 plays an oncogenic role in breast cancer, and could serve as a prognostic marker and possible target for attenuating deregulated cell proliferation in estrogen-dependent breast cancer.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | ATAACCCTATGGCCAGCAGA | 47335231-47335250(+) | up stream | 20 | GGG | CRISPRko | Experimental validated | MCF7 | paried with sgRNA2 | [1] |
| sgRNA2 | TTAAGAAGCTGAGGAAAGCA | 47335542-47335561(-) | down stream | 20 | AGG | CRISPRko | Experimental validated | MCF7 | paried with sgRNA1 | [1] |
GBrowser
Links
Reference
1. Singh R, Gupta SC, Peng WX, Zhou N, Pochampally R, et al. (2016). Regulation of alternative splicing of Bcl-x by BC200 contributes to breast cancer pathogenesis. Cell Death Dis 7(6): e2262.
