CCAT1
Species: Homo sapiens
Position: chr8: 127204411-127219268
Known as: CCAT1 , ENSG00000254166
Transcript: ENST00000500112 , NR_108049
Sequence: Download
Description:
The colon cancer associated transcript 1 (CCAT1) lncRNA is upregulated in various human malignant and pre-malignant tissues including colon adenocarcinoma, gastric carcinoma, ovarian cancer, hepatocellular carcinoma, and other kinds of cancers. CCAT1 is known to be involved in various normal and pathologic cellular processes such as proliferation, migration and metastasis, it was shown to also act as a competing endogenous RNA, and a regulator of cMYC.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | AATGGCTTTGGACTCCGATT | 127218427-127218446(-) | gene body (near 5') | 20 | TGG | CRISPRko | Experimental validated | HT-29;HCT116 | paried with sgRNA2 | [1] |
| sgRNA2 | ATAATGGAGGGGATTTACGT | 127219305-127219324(+) | up stream | 20 | GGC | CRISPRko | Experimental validated | HT-29;HCT116 | paried with sgRNA1 | [1] |
| sgRNA3 | CTGTTATCCGCAGCTCCATC | 127209508-127209527(-) | gene body (near 3') | 20 | TGG | CRISPRki | Experimental validated | SW-480;HCT116 | NA | [1] |
GBrowser
Links
Reference
1. Zare K, Shademan M, Ghahramani Seno MM, Dehghani H (2018). CRISPR/Cas9 Knockout Strategies to Ablate CCAT1 lncRNA Gene in Cancer Cells. Biol Proced Online 20: 21.
