Evx1as
Species: Mus musculus
Position: chr6: 52308388-52314832
Known as: Evx1os , ENSMUSG00000086126
Transcript: NR_038163 , ENSMUST00000125305
Sequence: Download
Description:
Evx1 is expressed from a complex locus, which also expresses a long non-coding RNA, known as Evx1as. Disrupt expression of Evx1 could also disrupt expression of Evx1. RNA-seq results convincingly show that loss of EVX1 and Evx1as produced identical aberrations in A-P gene expression patterns to those which was observed in the EVX1 loss-of-function cell lines. These results together strongly suggest there is no independent function for Evx1as beyond that of EVX1.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | CATTTGAAAAGGCGGGGATT | 52314845-52314864(+) | up stream | 20 | GGG | CRISPRko | Experimental validated | ESCs | paried with sgRNA2 | [1] |
| sgRNA2 | CAGAGTCCGCCACGATTTTA | 52314692-52314711(-) | gene body (near 5') | 20 | CGG | CRISPRko | Experimental validated | ESCs | paried with sgRNA1 | [1] |
| sgRNA3 | ATCCACTTGCGTTCGCCGAG | 52313534-52313553(+) | gene body (near 5') | 20 | TGG | CRISPRko | Experimental validated | ESCs | paried with sgRNA4 | [1] |
| sgRNA4 | TGGGCCTCGCTCGAATGGGG | 52313441-52313460(-) | gene body (near 5') | 20 | AGG | CRISPRko | Experimental validated | ESCs | paried with sgRNA3 | [1] |
| sgRNA5 | CACACCTGGTACTGGCATAC | 52315308-52315327(+) | up stream | 20 | TGG | CRISPRko | Experimental validated | ESCs | paried with sgRNA6 | [1] |
| sgRNA6 | TCATTAGAACACGCCGTTTG | 52312645-52312664(+) | gene body (near 5') | 20 | TGG | CRISPRko | Experimental validated | ESCs | paried with sgRNA5 | [1] |
GBrowser
Links
Reference
1. Bell CC, Amaral PP, Kalsbeek A, Magor GW, Gillinder KR, et al. (2016). The Evx1/Evx1as gene locus regulates anterior-posterior patterning during gastrulation. Sci Rep 6: 26657.
