Gm26878
Species: Mus musculus
Position: chr8: 120879398-120882481
Known as: Gm26878 , ENSMUSG00000097087
Transcript: XR_388115 , ENSMUST00000181778
Sequence: Download
Description:
Gm26878, present in the mouse enhancer region syntenic with the human FOXF1 upstream enhancer is partially neonatal lethal, but does not affect the expression of Foxf1. Our data indicate the involvement of Gm26878 in mouse embryonic development independently or downstream of Foxf1, and point to differences in the regulation of FOXF1 expression between mouse and human.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | TGGCCTCTGGGTCGGGACCC | 120880082-120880101(+) | gene body (near 5') | 20 | TGG | CRISPRko | High activity | embryo | Mutation rate 33%,paried with sgRNA2 | [1] |
| sgRNA2 | TTATGGACTCCGGACTAGAA | 120882476-120882495(+) | gene body (near 3') | 20 | AGG | CRISPRko | High activity | embryo | Mutation rate 33%,paried with sgRNA1 | [1] |
GBrowser
Links
Reference
1. Szafranski P, Karolak JA, Lanza D, Gajęcka M, Heaney J, et al. (2017). CRISPR/Cas9-mediated deletion of lncRNA Gm26878 in the distant Foxf1 enhancer region. Mamm Genome 28(7-8): 275-282.
