LINC-ROR
Species: Homo sapiens
Position: chr18: 57054557-57072119
Known as: LINC-ROR , ENSG00000258609
Transcript: NR_152602 , NR_048536 , ENST00000553704 , ENST00000645956
Sequence: Download
Description:
LINC-ROR was originally identified to be able to regulate reprogramming of iPSCs. Our previous study suggests the potential oncogenic role of LINC-ROR in cancer progression. The present study provides further evidence that LINC-ROR functions as an oncogene. LINC-ROR may contribute to the increased stability of c-Myc mRNA. Although hnRNP I and AUF1 can interact with many RNA species and regulate their functions, with involvement of LINC-ROR they would be able to selectively regulate mRNA stability of specific genes such as c-Myc. Together, these results support a role for LINC-ROR in c-Myc expression in part by specifically enhancing its mRNA stability, leading to cell proliferation and tumorigenesis.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GATGGCATTTCAGTTCTTCC | 57056244-57056263(-) | gene body (near 3') | 20 | AGG | CRISPRko | Experimental validated | HCT116 | paried with sgRNA2 | [1] |
| sgRNA2 | GACCCTGTTTTTAATTCGTT | 57054501-57054520(+) | down stream | 20 | TGG | CRISPRko | Experimental validated | HCT116 | paried with sgRNA1 | [1] |
GBrowser
Links
Reference
1. Huang J, Zhang A, Ho TT, Zhang Z, Zhou N, et al. (2016). Linc-RoR promotes c-Myc expression through hnRNP I and AUF1. Nucleic Acids Res 44(7): 3059-69.
