LINC00173
Species: Homo sapiens
Position: chr12: 116533421-116536513
Known as: LINC00173 , ENSG00000196668
Transcript: NR_027345 , NR_027346 , ENST00000480237 , ENST00000489452 , ENST00000470091
Sequence: Download
Description:
LINC00173, a large intergenic non-coding RNA predominantly in the nucleus of various human cell types, is conserved amongst mammals and at least a partial homolog appears to be present in chickens. Both transcript variants of LINC00173 are up-regulated during infection with HIV-1 in a dose- and time-dependent manner. Nonetheless, loss of the LINC00173 locus does not affect any aspect of the HIV-1 replication cycle in cell culture, from entry to particle production. The cytokines exhibiting increased expression in the lnc173 KO Jurkat clones include IFN-r, a cytokine of central importance to the development and maintenance of the adaptive immune response to intracellular pathogens, including viruses. It is therefore tempting to speculate that HIV-1 has evolved the ability to increase levels of lnc173 to impede the immune response.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | TCCCACCTGCTCTAAGCGCT | 116533441-116533460(+) | gene body (near 5') | 20 | TGG | CRISPRko | Experimental validated | HEK293T | paried with sgRNA3,4 | [1] |
| sgRNA2 | GCTCTAAGCGCTTGGTACCA | 116533449-116533468(+) | gene body (near 5') | 20 | GGG | CRISPRko | Experimental validated | HEK293T | paried with sgRNA4 | [1] |
| sgRNA3 | AGATCACGTGAACTGGTGAT | 116536412-116536431(+) | gene body (near 3') | 20 | GGG | CRISPRko | Experimental validated | HEK293T | paried with sgRNA1 | [1] |
| sgRNA4 | ACCATTTGGCTCCTATGCAC | 116536549-116536568(+) | down stream | 20 | AGG | CRISPRko | Experimental validated | HEK293T | paried with sgRNA2 | [1] |
GBrowser
Links
Reference
1. Postler TS, Pantry SN, Desrosiers RC, Ghosh S (2017). Identification and characterization of a long non-coding RNA up-regulated during HIV-1 infection. Virology 511: 30-39.
