LINC00657
Species: Homo sapiens
Position: chr20: 36045617-36050960
Known as: NORAD , ENSG00000260032
Transcript: NR_027451 , ENST00000565493
Sequence: Download
Description:
We selected LINC00657 to determine their role in breast cancer, and found that LINC00657 knockout significantly suppresses tumor cell growth and proliferation, suggesting that it plays an oncogenic role. These results highlight the clinical significance of lncRNAs, and thus, the lncRNA may serve as prognostic markers for breast cancer.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | TTCCGGTCCGGCAGAGATCG | 36050939-36050958(-) | gene body (near 5') | 20 | CGG | CRISPRko | Experimental validated | LM-4142 | paried with sgRNA2, known as NORAD | [1] |
| sgRNA2 | ACTCTATTCTACAAGCAACG | 36045593-36045612(+) | down stream | 20 | AGG | CRISPRko | Experimental validated | LM-4142 | paried with sgRNA1, known as NORAD | [1] |
| sgRNA3 | GTTGCGAAGAGCAAGCGGGG | 36051117-36051136(-) | up stream | 20 | TGG | CRISPRa | Experimental validated | LCLs | known as NORAD | [2] |
| sgRNA4 | TCTGCAATGTTCCGGCGTGG | 36051044-36051064(+) | up stream | 20 | GGG | CRISPRa | Experimental validated | LCLs | known as NORAD | [2] |
GBrowser
Links
Reference
1. Liu H, Li J, Koirala P, Ding X, Chen B, et al. (2016). Long non-coding RNAs as prognostic markers in human breast cancer. Oncotarget 7(15): 20584-96.
2. Wang C, Li D, Zhang L, Jiang S, Liang J, et al. (2019). RNA Sequencing Analyses of Gene Expression during Epstein-Barr Virus Infection of Primary B Lymphocytes. J Virol 93(13).