LOC646329
Species: Homo sapiens
Position: chr7: 130877561-131110176
Known as: LINC-PINT , ENSG00000231721
Transcript: NR_109855 , NR_109854 , NR_109853 , NR_015431 , NR_109852 , NR_109851 , NR_109850 , NR_024153 , NR_110473 , NR_110472 , NR_034120 , ENST00000451786 , ENST00000647388 , ENST00000643135 , ENST00000644804 , ENST00000646587 , ENST00000647288 , ENST00000642156 , ENST00000433079 , ENST00000645248 , ENST00000646429 , ENST00000642602 , ENST00000643855 , ENST00000643373 , ENST00000642483 , ENST00000643874 , ENST00000431189 , ENST00000644188 , ENST00000423414 , ENST00000435523 , ENST00000443623 , ENST00000416999
Sequence: Download
Description:
LOC646329 is a lncRNA enriched in single radial glia cells but is detected at low abundance in tissues. CRISPRi knockdown of LOC646329 indicates that this lncRNA regulates cell proliferation. The discrete and abundant expression of lncRNAs among individual cells has important implications for both their biological function and utility for distinguishing neural cell types.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GCTTAGGAAATCACCAGCTCC | 130912984-130913004(+) | gene body (near 3') | 21 | TGG | CRISPRi | Experimental validated | U87 | NA | [1] |
| sgRNA2 | GGTCTGCCGTGACAGTTCAGT | 130913085-130913105(+) | gene body (near 3') | 21 | AGG | CRISPRi | Experimental validated | U87 | NA | [1] |
GBrowser
Links
Reference
1. Liu SJ, Nowakowski TJ, Pollen AA, Lui JH, Horlbeck MA, et al. (2016). Single-cell analysis of long non-coding RNAs in the developing human neocortex. Genome Biol 17: 67.
