Lncenc1
Species: Mus musculus
Position: chr13: 97434969-97497664
Known as: Lncenc1 , ENSMUSG00000078952
Transcript: NR_110430 , NR_110431 , NR_110432 , ENSMUST00000179324 , ENSMUST00000109431
Sequence: Download
Description:
Lncenc1, a highly abundant long noncoding RNA in nESCs. Knockdown or knockout ofLncenc1in mouse nESCs leads to a significantly decreased expression of core pluripotency genes and a significant reduction of colony formation capability. Furthermore, upon the depletion ofLncenc1, the expression of glycolysis-associated genes is significantly reduced, and the glycolytic activity is substantially impaired, as indicated by a more than 50% reduction in levels of glucose consumption, lactate production, and extracellular acidification rate. Mechanistically, Lncenc1interacts with PTBP1 and HNRNPK, which regulate the transcription of glycolytic genes, thereby maintaining the self-renewal of nESCs. Our results demonstrate the functions ofLncenc1in linking energy metabolism and naive state of ESCs, which may enhance our understanding of the molecular basis underlying naive pluripotency.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GAGCCAATCTCTAGGCAAGT | 97482677-97482696(+) | gene body (near 3') | 21 | AGG | CRISPRko | Experimental validated | ESCs | paried with sgRNA2 | [1] |
| sgRNA2 | GTATGACAAATGCTTATTGA | 97497723-97497742(+) | down stream | 20 | AGG | CRISPRko | Experimental validated | ESCs | paried with sgRNA1 | [1] |
| sgRNA3 | GTGCTTTTGTGTTATCCCGG | 97494082-97494101(-) | gene body (near 3') | 20 | TGG | CRISPRko | Experimental validated | ESCs | paried with sgRNA4 | [1] |
| sgRNA4 | GGTCCATTATGTAACCACCT | 97497874-97497893(+) | down stream | 20 | TGG | CRISPRko | Experimental validated | ESCs | paried with sgRNA3 | [1] |
GBrowser
Links
Reference
1. Sun Z, Zhu M, Lv P, Cheng L, Wang Q, et al. (2018). The Long Noncoding RNA Lncenc1 Maintains Naive States of Mouse ESCs by Promoting the Glycolysis Pathway. Stem Cell Reports.
