Rian
Species: Mus musculus
Position: chr12: 109603944-109661716
Known as: Rian , ENSMUSG00000097451
Transcript: NR_028261
Sequence: Download
Description:
Rian is a 57.8kb long noncoding RNA gene with alternative splice forms generated during transcript maturation. Mutation of Rian has differential effects on expression of nearby genes in different somatic tissues. Rian selectively regulates nearby genes in different tissues. The selective regulation of nearby genes in different tissues may indicate a tissue-specific function of Rian.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GGCCTTCAGTGAACCATGGA | 109640813-109640832(-) | gene body (near 3') | 20 | TGG | CRISPRko | Experimental validated | embryo | NA | [1] |
| sgRNA2 | GGAAGTTGTTGTTAAACAGT | 109642575-109642594(+) | gene body (near 3') | 20 | GGG | CRISPRko | Experimental validated | embryo | NA | [1] |
| sgRNA3 | GGCCAGCAATCATGTCTCAG | 109663967-109663986(+) | down stream | 20 | TGG | CRISPRko | Experimental validated | embryo | NA | [1] |
| sgRNA4 | GGCAAGGTTAGGATTATACAA | 109664083-109664103(+) | down stream | 21 | TGG | CRISPRko | Experimental validated | embryo | NA | [1] |
GBrowser
Links
Reference
1. Han J, Zhang J, Chen L, Shen B, Zhou J, et al. (2014). Efficient in vivo deletion of a large imprinted lncRNA by CRISPR/Cas9. RNA Biol 11(7): 829-35.
