TERC
Species: Homo sapiens
Position: chr3: 169764609-169765060
Known as: TERC , ENSG00000277925
Transcript: NR_001566 , ENST00000363312
Sequence: Download
Description:
TETC is used as a prototypic lncRNA to investigate the CRISPRi efficiency. We selected and cloned up to three sgRNAs each targeting six characterized lncRNAs (GAS5, H19, MALAT1, NEAT1, TERC, XIST) with good evidence of expression in K562 cells. 50% of transducing the sgRNAs into cells expressing dCas9-KRAB yielded >85% knockdown.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GTCTAACCCTAACTGAGAA | 169764999-169765017(-) | gene body (near 5') | 19 | GGG | CRISPRi | Experimental validated | K562 | NA | [1] |
| sgRNA2 | GCCTACGCCCTTCTCAGTTA | 169764989-169765008(+) | gene body (near 5') | 20 | GGG | CRISPRi | Experimental validated | K562 | NA | [1] |
GBrowser
Links
Reference
1. Gilbert LA, Horlbeck MA, Adamson B, Villalta JE, Chen Y, et al. (2014). Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Cell 159(3): 647-61.
