tie-1as
Species: Danio rerio
Position: chr6: 33983868-33984666
Known as: tie-1as
Transcript: NR_036574
Sequence: Download
Description:
tie1 AS long noncoding RNA interacts with an RNA binding protein -- embryonic lethal and abnormal vision Drosophila-like 1 (Elavl1) -- that regulates tie1 mRNA levels. When we disrupted the interaction between tie1 AS and Elavl1 by using constitutively active antisense morpholino oligonucleotides or photoactivatable morpholino oligonucleotides, tie1 mRNA levels increased between 26 and 31 hours post-fertilization, particularly in the head. This increase correlated with dilation of primordial midbrain channels, smaller eyes, and reduced ventricular space. We also observed these phenotypes when we used CRISPRi to knock down tie1AS. Treatment of the morpholino oligonucleotide-injected embryos with a small molecule that decreased tie1mRNA levels rescued all 3 abnormal phenotypes.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | CATGAGTTGTTTTCTTCAGT | 33983901-33983920(-) | gene body (near 5') | 20 | TGG | CRISPRi | Experimental validated | embryo | NA | [1] |
| sgRNA2 | GAGGTTGACTTGCGTTTTCT | 33983828-33983847(+) | up stream | 20 | GGG | CRISPRi | Experimental validated | embryo | NA | [1] |
| sgRNA3 | CACAAAAGCTCAATTAGCAT | 33983782-33983801(+) | up stream | 20 | AGG | CRISPRi | Experimental validated | embryo | NA | [1] |
GBrowser
Links
Reference
1. Chowdhury T, Koceja C, Eisa-Beygi S, Kleinstiver B, Kumar S, et al. (2018). Temporal and Spatial Post-Transcriptional Regulation of Zebrafish tie1 mRNA by Long Noncoding RNA During Brain Vascular Assembly. Arterioscler Thromb Vasc Biol 38: 1562-1575.
