LncRNA Gene

ZFLNCG06515

Basic Information

Chromesome: chr10

Start: 41886928

End: 41887205

Transcript: ZFLNCT09982

Known as: ENSDARG00000094870

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
ERR023143 swim bladder normal 6.20
SRR1167757 embryo mpeg1 morpholino and bacterial infection 1.10
SRR800043 sphere stage normal 0.57
SRR1562533 testis normal 0.48
SRR1205160 5dpf transgenic sqET20 and GFP+ 0.25
SRR658539 bud Gata5/6 morphant 0.25
SRR1205163 5dpf transgenic sqET20 and neomycin treated 3h and GFP+ 0.25
SRR658535 bud Gata5 morphant 0.23
SRR797911 embryo prdm1-/- 0.17
Express in tissues
Correlated coding gene

Correlated coding gene of this lncRNA gene hava does not exist!

Gene Ontology

Gene Ontology of this lncRNA gene hava does not exist!

KEGG Pathway

KEGG pathway of this lncRNA gene hava does not exist!

Conservation
Zebrafish lncRNA Transcript Human lncRNA Transcript Mouse lncRNA Transcript Methods
ZFLNCT09982 ENST00000486251; NONHSAT125668; NONHSAT104458; NONHSAT024249; NONHSAT125667; ENSMUST00000117794; ENSMUST00000172211; ENSMUST00000174168; ENSMUST00000173181; ENSMUST00000172477; NONMMUT010656; NONMMUT029607; NONMMUT010657; NONMMUT029605; NONMMUT029606; Collinearity with conserved coding gene
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG06515
CTAAACCTTCCATTACACATTTACCATTCTTCATCAAAGTTTAACTTACACTTGCTGGTGTACAACACAG
AAAAATGACAGAAAAACCTCAAATATAAAGTTATCATCACAGCACAAGGAAACAGCAAAGTATGGTACAC
ATTGGTGACTATCCATGCAAAACGTATCATTAGAGAACACTGTCCATAACACACATCTGTTCTATATGTA
GTGTCAAAATGTCAATTGCTGTTTGAAGGGACAGTGACATAATCTGATAAGCAAAACTAGCAGATAC