LncRNA Gene

ZFLNCG08909

Basic Information

Chromesome: chr16

Start: 14084152

End: 14084478

Transcript: ZFLNCT13741

Known as:

Genome Browser
Express profile Download
Express in top 10 samples
Sample Tissue Condition FPKM
ERR594418 retina transgenic flk1 and develop tumors 44.82
ERR594417 retina normal 35.51
ERR594416 retina transgenic flk1 22.52
SRR658537 bud Gata6 morphant 18.26
SRR514030 retina id2a morpholino 18.16
ERR023144 brain normal 17.28
SRR1049946 embryo transgenic TgOMP-Gal4 and UAS-GCaMP1.6 and treated with DMSO 16.69
SRR514028 retina control morpholino 15.07
SRR1205154 5dpf transgenic sqET20 13.57
SRR1205151 5dpf transgenic sqET20 and neomycin treated 1h 13.56
Express in tissues
Correlated coding gene Download
gene correlation coefficent
si:dkey-26c10.6 0.67
aqp9a 0.62
LOC101886429 0.58
hunk 0.56
six7 0.56
LOC100007990 0.56
zgc:158291 0.56
rs1b 0.55
cabp2a 0.54
gnb1a 0.54
Gene Ontology Download
GO P value
GO:2001141 1.41e-04
GO:0051252 1.69e-04
GO:0019219 2.34e-04
GO:0010556 2.67e-04
GO:0031326 3.27e-04
GO:0009889 3.37e-04
GO:0051171 3.76e-04
GO:0006355 6.06e-04
GO:1903506 6.10e-04
GO:0050794 9.25e-04
GO:0005634 7.74e-03
GO:0031252 7.87e-03
GO:0034751 1.05e-02
GO:0034753 1.05e-02
GO:0032587 1.31e-02
GO:0072686 1.83e-02
GO:0000777 2.08e-02
GO:0031256 2.60e-02
GO:0043231 2.69e-02
GO:0043227 2.77e-02
GO:0001071 1.49e-05
GO:0003700 1.49e-05
GO:0030274 4.02e-05
GO:0000981 6.00e-05
GO:0019904 7.46e-04
GO:0043565 9.10e-04
GO:0003824 1.95e-03
GO:0003677 3.31e-03
GO:0042577 5.25e-03
GO:0051800 5.25e-03
KEGG Pathway Download
KO P value
ko04724 1.62e-04
ko04725 1.97e-04
ko04727 1.11e-03
ko05032 1.11e-03
ko04713 2.06e-03
ko04744 2.13e-03
ko04723 4.21e-03
ko04371 4.34e-03
ko04062 6.20e-03
ko04740 1.02e-02
Conservation
OMIM

OMIM of this lncRNA gene hava does not exist!

Sequence Download
>ZFLNCG08909
GGGAGTCTCCCATATTTTAGACTCATCTTCCGCCACCCTCACGTTTTGTTATTTCTTCCGGAAAACTCCC
GTAATTTCAACCATACCACCCTCCTGGTCCTCAGCATTTTGGTACGGTTTGTGAAACCCCTGGGTCGTCA
ACAATGGTATAGGATACGATTGCAGCGGCCGCCCAAATCACACATCATAGTACAGTTACTAACACCACAG
TACACAGTACCCAGTTCTCAACAGTCAACAGTGTTCTTCTGACACCTCACTCCCAAACCAAACCCTCAGG
TATCCCATATTTTCATGGATTAATGTTGGCAGGTATGCCATCAACC